Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ694951
Length 670 bp
Fasta Format > whsc19b18
tggcatttgctttgaggtctgtgatgttgttctccacactgatgctatcc acaggggtggtggtcaggtcattcccacggccaggagggtcatttatgct tctcagctgactgccaagccaaggctgctggagcctgtgtacctggttga gatccaggccccggagaatgcgcttggtggtatctatggtgttctgaatc agaagagagggcacgtgttcgaggagatgcagaggcaaggtaccccgctc tacaacatcaaggcctacctccccgtcattgaatcctttgggttctcaag caccctgagggccgcgacgtccggccaggccttcccccagtgtgtgtttg accactgggacatcatggcttctgatcctttggacccaggcacccagtcg gcgacgctcgtcacggatatccgcaagaggaagggcctcaaggagcagat gacccctctatccgatttcgaggacaagctctaaatttttggtgctgtta tcccttacctggtcttgtgttgttaaagagagctgcactattttgtatcg atgagtcttgctgttatgacctacttgtcgtgatactgggaactatgttt tgatgtctggtgatgtaacggatgttttacttanattatctatctgttgt ccactggttcaaaaaaaaaa
Download
page-top