Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ226569
Length 658 bp
Fasta Format > whdl18a18
gcttaggtttcagttctcctccgcctccggtctcgagagctcgccagaat ggtcgcccacaggttccaccagtaccaggtggtgggtcgcgcgctgccgg cccccggcgatgagcagcccaagatctaccgcatgaagctctgggccacc aatgaggtccgcgccaagtccaagttctggtacttcctgaggaagctcaa gaaggtgaagaaggccaacggccagatgctcgccatcaacgagatctttg agaagaaccccaccacaatcaagaactacggcatctggctgaggtaccag agcaggaccggttaccacaacatgtacaaggagtaccgtgacacgaccct caacggcggggtggagcagatgtacacggagatggcgtcgcggcaccgcg tgcgtgccccctgcatccagatcatcaagactgcgacggtggacttcaag ctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagtt cccgctggtgtaccagaaggttcgcccacccacccgcaagctcaagacca cctacaaggcgacgaggcccaacctcttcatgtgagcgggtccctactct actggcctgtgtgttttagcgtgtaagagtttgaagatttttgcatgtgg aagttttg
Download
page-top