Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ694698
Length 556 bp
Fasta Format > whsc18c05
agatcgcagatctgctccggtgagaatccgtcgccatgtcttccagcgag gtcgcctgcacccttgccgccctcatcctccacgatgacgggatccccat cacttctgagaagatcgcgacggtggtgaaggctgccggaatcaaggttg aggcctactggcccgcgctcttcgccaagctcctggagaagaggagcgtc gatgacctcatcctttccgtcggatctggtggaggtggtgctccagctgc tgctgctgctgccccggctgctggtggtgctgctgccgctgaagagaaga aagaagagaaaaaggaggaggctaaggaagagagcgatgatgacatgggc ttcagcttgttcgactaagcagttcaattccagttctcctgtggaatctt ttatgctaaggattacttatcttatgtgcttttaggtcgaattttgcgga tttaatatgtttgagacctaagtatctgtgcaatgagtactgcaaaccac cttgggatggtctttttagaatgaaaatggttttggtgcttggttgaaaa aaaaaa
Download
page-top