Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ694568
Length 713 bp
Fasta Format > whsc17k17
cgccgccaggccgacgccaagttggcggtgaagagcaagggggcggagaa gccggccgccaaggggaagaagggcaaggccggcaaggaccccaacaagc ccaagagggcgccatccgccttcttcgtcttcatgggcgagttccgcgag gagttcaagcagaagaaccccaagaacaagtccgtcgccgccgtcggcaa agcggccggtgagaggtggaagagcttgagcgaatcggaaaaggccccct atgtggccaaggccaacaagctcaagggcgagtacaacaaggccattgct gcctacaacaagggcgagagcgctgctgctgctgccccaaagaaggctgc ggccaaggaggtagaggaggaagatgaggaggaatctgacaagtccaagt cggagatcaatgacgacgatgacgatgagggcagcgatgaggacgaggac gatgacgagtgaagaagacgcatcttgtcaaggctgctccggcggacaag tcgggagctgctgtgcgagaacggacctgagctgtgtgcggtggtgtcat aangagcctatccatctccactanaattatcccaagtttcacttcacatc ntgatgttgttttacctttttcctgtcattgtcctgctataacggatanc gctccctgttggcnccgccnccggcggggatgccctantggtgnangntg tatntcctcttcc
Download
page-top