Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ694523
Length 375 bp
Fasta Format > whsc17i07
ggcgagagcnctgctgctgctgccccaaagaaggctgcggccaaggaggt ataggaggaagatgaggaggaatctgacaagtccaagtcggagatcaatg acgacgatgacgatgagggcagcgatgaggacgaggacgatgacnagtga anaagacgcatcttgtcaaggctgctccggcggacaagtcgggagctgct gtgcgagaacggacctgagctgtgtgcggtggtgtcataangagcctatc catctccactanaattatcccaagtttcacttcacatcntgatgttgttt tacctttttcctgtcattgtcctgctataacnnatancgctccctgttgg cnccnccnccngcggnnatncccta
Download
page-top