Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ694297
Length 616 bp
Fasta Format > whsc16l03
gctgagctcaacaccactactactgcaaactcaatagggatggctcgcgg tgcagctactcagctcgtgctggtcgccttggtggccgctatgctcctcg tagcctgcgatgcggcgatatcctgcggtcaggtgacctctgccttgagc ccctgcatctcctatgcacgcggcaatggcgccaacccgcctgcggcctg ctgcagcggcgtcaggagtctggccggtgcagcccggagcaccgctgaca agcaagcagcgngcaagtgcatcaagagcgctgctggtgggctcaacgct ggcaaggccgccggcatcccttcaaagtgcggcgtcagcgtcccctacgc catcagctcatctgtggactgttctaagattcnttgatcgaccacttctt ctcatcatcgctgcatatagctccagcgatctacgctgagtacgttgagg tcatacacatacatatacatatatatgaataagtgctctcatattatctc actgcgtgacagcgagaggagtacctacgtccggccagctctgcatggca ggccacactgttgtattgatgtttggttgctccttcacccttttnanagg actcatgantttgcgg
Download
page-top