Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ694075
Length 606 bp
Fasta Format > whsc15n04
cggcggcacgcggcggcgcagcttgtttcaaggtcggcacatcctgcagg ccagttgaagtcggcctaccacccctggaccagcccaaagccgagtcacg gccgcaccgcaactcgccagcttccgcgcaccagctgcgccgccctcgcc aggcagcgatatctcctatctctcctgccggcgggtcggtggttccagcg gacaagatgctgggcgtctccaccagccagcttttggtcatcctcggggc ctgctccgtgatgatgaagcccagtgacatgatcaagatggcaagggtgg cagggaggatgaccgggagagcggtcggtcgcctcatgctctaccgccgg cagatggacgacatcttcgagcagactgcagcgaagaagattaatacgga gcttcaagatgccatgtcaaagttacaatcaattggttatgaagttcaga acttatctagaataactcctggccagtttatcaaaaggcagcacaacacc gagggcatgactgaagcaggaacatatgatggttctgcaactcantctgg agaatttcgtgatgatattcncagtataattcntgatgaaattganagct tttgta
Download
page-top