Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ693828
Length 600 bp
Fasta Format > whsc14n09
attcggcacgagggtctccccgcctacgccgccgcagccgcctcctgcta cccgccgccgagatgacgaagcgcaccaagaaggccggaatcgtcgggaa gtatggtaccaggtatggtgccagtttgcgtaagcagatcaagaagatgg aggtgtctcagcactccaagtacttctgtgaattctgtgggaagtttgct gtgaagaggaaagctgttggaatttggggatgcaaggactgtggcaaggt caaggctggcggcgcctataccatgaacactgctagtgcagtcaccgtca ggagcacgatccgtcgcttgagggagcagaccgaagcatgattgccctac tgttgtcttgaggaatccaggggttctgtagtggagtgaagacttaacaa tctctgtattttggctatcgagcgatggatatctgttagtaattttggtt ctgattttaggatctttgaaacttgaaagtatgtccctacagctgcctgt tatgcgttatgccaacctatttgtatttttgtgacacgtctctcactctc tacccctctgcaccccaagtcaatcttatatgataaggttttannanana
Download
page-top