Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ692847
Length 642 bp
Fasta Format > whsc10n14
aagaggcttttctgagaagctcaaatggctcccaaagttgctgttgccaa gaagggcgatgccaaggcccaggccgccaaggttgccaaggctgtgaagt ctgggtcaatcaagaagacggcaaagaagatccgcacttctgtgacattt caccgccccaagaccctgtccaaggccagggaccccaagtaccccaggat cagcacccctggaaggaacaaattagaccagtaccagatcctcaagtacc cgcttaccactgagtctgcgatgaagaagattgaagacaacaacaccctt gtcttcattgtcgacctcaaggccgacaagaagaaaataaaggctgctgt caagaaaatgtatgacattcaggccaagaaggttaacaccctcatcaggc ctgatggcaagaagaaggcgtacgtgaagctgacaccagactacgatgct cttgacgtggccaacaagatcggcatcatataagccagagggagggtcct gcagtaggcgcttgtgtcgtggtttcttatgttattggaattttgtagtt gttacttagcaaagggccttantggctccattgcctaccatatcgctgca cactttcatgaatttgatgcaatcgaagtgacttgtgttgat
Download
page-top