Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ692787
Length 657 bp
Fasta Format > whsc10k06
catccgagtccgaggaggaggaggttcctaagaagactgcaaagcctgtc aaacacgagtcttcagatgatagcagcgacgattcctcctctgacgagga acctgcaaagaagccttctgctaaacctgtgaccccagctgccagcaacg gctcaaagaaaggcaagcctgagagcagctcttctagttctgaggatgag tccgatgatgacgagaaacctgctgctctggtaaagaaaacaccagccat cgaatctgacagctccgaaagtgactcagatgatagctcagatgaggatg ttcctgccaagactcctgctgctgctgccaagaaggtagattcttcagac agttctgagtcggagagtgaatctgaggatgaggagaaatcaaagaaagc cgcacaggccaccaagatagctcctgcagctgctaaaagaaaggaggagc ccagtgattcctcagacagtgatgagagtgatgaagagcctccccagaaa aagctgaaggatgctgcgaaggttactcctaagtctgccaaaaaggacag caccagtgatgatgacagttctgatgaaagctctgatgatgagcctaaaa agaaagttacaactgccacaaaatcacagaaggaagagcctaaaactcct gctagca
Download
page-top