Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ692768
Length 658 bp
Fasta Format > whsc10j08
catttggctcaggtctagtgtaccaaacgggcagcccaaatggcttctgt ctttcataccgggttacccgatgcttaacttcatgctaacgacatcaatc tatcttttgctatcataccgggtatttgagatcacaaacgtgttgagggc agccttcattcctagcagagataacaaccgcctgtaccagaatttcgttg ccggggttgtcatctctgtatgtctgtattgctgctcactcgttcttcta aaaattccggctgtatagatgaatagttcttatggatgtagaattgccaa gtaaatgataccggtggaaggctgcttcttccacacgcacaaacgaggtt tgcttggcggggatgcccggtcccatttgcatctaggggctcccctaaga agctgcccttgggaacttgatcgccgtggagggagacgcaaatttttgat catttttcttgttgtaaaagccaacccattcttctgggagttgtaacagc tgtcagccgtgtaactgtcaactttggtgtgcaccttgttgttttgtaac ctgtcttanatattcttctatacatacaaggaaagcgtttccctcctgta aaaaagaaatancgagtcaacgcatgaactgtgaagcataccttgtcgtg ctctgaat
Download
page-top