Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ692692
Length 652 bp
Fasta Format > whsc10e16
cgctttcagaggcgaaaggccatggggagagatttttctgtgatccatgg atctccgatcgggaaaccgtatccaagctccgtggctagtctgcgctctt tggacttttcaaacttagcgaactgaaacatctgagtagctaaaggaagg aaaatcaaccgagaccccgttagtagcggcgagcgagagcggaacaaggg ttttcatcaaaagaaatccgaagcggtttcattcgatttgttgtggattg gatgatggaaaaaccagcaagcagcaagcgtagttagaaaagttgccgta gcgcgccctacggagttgtacaaagtcagcaaccgttttggggcgcaagc ataggcaacacaggactgatgacggggtggggcgcgcagtgaactggttt tctaaaaagattggaagatccggccaaagaaggtgatagccctgttcatt cgttcccatggttcgatccttcccagtaaaacgcggcgtgttcgaatgat gatcgcttttacgcgagaaagggggaccaccctctaagcctaagtattcc tcaatgaccgatagcgtacaagtaccgtgagggaaaggtgaaaagaaccc caatcggggagtgcaatanagaacctganatccgatgcgaacaatcantc na
Download
page-top