Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ696539
Length 782 bp
Fasta Format > whsc5c10
cttttacccagagaacaaaagagttaagaggttgagcctcattcggataa atatctggcaaacaaataattcaggtacattcatcatccaggacaaatct gaaactaaggaaacatatcattatcccaatcaagctcctcagacaatggc atttgctgcgctagcgatcctaggccagaggtcagcacactccttaccaa tgggtcctgtgatagcagatcctttcatctcacccttaggattcacaatc accccagcattatcttcgaagtacatgaagacaccgtcctttcggcgcca tggcttgcgctggcgcacgatgaccgccggcatgaccttcttcctgaggt cgggcttccccttcttgacggtggccatgaccatgtcgccgacgcaggcc gacggcaggcggttgagccttcccttgatgcccttcacggagatgatgta caggttcttggcgcccgtgttgtcggcgcagttcaccgtcgctgccaccg gcagacccagcgacatcctgaacttgttccccgccgatcctcccctcccg cgcttcgacatggcggcgtcccctgcggcgcttgctcccctcgtgccgat tcggcacgaggttgaacatgggtgtcaactttcttctgtctgcagagatt gaccatccgaanaanaactacaagtttggttttggaatgactgtangaga ntanatatgctcacancaattactgtgagaggactacanatgtctcctca nntcnttataantgcangnttaccatatggnc
Download
page-top