Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ696456
Length 664 bp
Fasta Format > whsc4n15
agtccgccaaggccatgggccgggacctgcgtgttcatttcaagaacact agggaaacagcgtttgccctgaggaagatgtcgctcaacaaggccaagag gtaccttgaggatgtgttggcacacaagcaagccatccccttccggaggt actgccgtggtgttggacgcacagcccaggtgaagaaccgtcagcccaat ggtcagggacgctggcctgccaagtctgctaagttcgttctggatcttct aaagaatgctgagagcaatgctgaggtgaaaggtcttgatgttgatgctc tctacatttcacacatccaagtgaaccaggcccagaagcagcggcgccgg acctaccgtgcccatggacgcatcaacccctacatgtccaacccatgcca cattgagctgatcttgtcggagaaggaagagccggtgaagaaggaggctg agtcccagattgccaggaaggcctanagaaggaagctctacataacctat ctgcctattcgttagagcagtttgtagcatctggtctggctgagtcgaaa tttttggcctattatctgtcgtctaaatactgctagctcatactttgtga aaccttttgatgatcgtctcatgtactggattcaatctggttgtgttttg gaataaaaaaaaaa
Download
page-top