Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ696422
Length 774 bp
Fasta Format > whsc4l05
gggcgtcagatggagttgatcgatgccgcatttccacttctcaagggagt tgttgcaacaactgatgttgttgaggcttgcactggtgtgaatgttgcgg ttatggttggtggattccccaggaaggaaggaatggaaaggaaggatgtt atgacgaaaaatgtttcaatctacaaagctcaagcatctgctcttgaagc tcatgcagcccccaattgcaaggttttggttgttgccaacccagcaaaca ccaatgctctcatcctgaaggagtttgctccatctatccctgagaagaac atcagttgtttgacccgcctagaccacaacagggcactcggtcagatttc tgagagacttggtgtccaagtttctgacgttaagaatgctattatctggg gtaatcactcgtccagtcagtatcctgatgttaaccatgccactgtgaag actcccagtggagagaagcctgttcgtgaacttgttcaagatgatgaatg gctaaatggggagttcattgccactgtccagcagcgtggtgctgcaatca tcaaagcgaggaagctctccagtgctctctctgctgccagctcagcttgt gatcacatccgtgactgggttctgggaaccgctgagggaacatttgtttc catgggtgtgtactctgatggttcatacggtgtgcctgctggtcttatct actccttcccantaacgtgcagtggtggtgaatggacaattgttcaangg ctcccnatcgatganttctcnang
Download
page-top