Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ696125
Length 656 bp
Fasta Format > whsc3j06
gtggcagacactcattgaggctcatgtggatgtgaagaccactgacaact acatgctccgcatgttcaccattggcttcacgaagagacgcccaaaccag gtgaagcgcacttgctatgcccaagcaagtcagatcagacagatccgccg caagatggttgagatcatggtcaaccaagctgcaagctgtgacttgaagg agcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaag gccacctcaagcatcttccccctccagaacgtgtacgtccgcaaggtgaa gatcctgaaggcccccaagtttgacctggggaagctcatggaggtgcacg gtgactacaaggaggatgttggtgtgaagcttgacaggcctgctgatgga gatgaggtgattcctggagcggaggaggttgctgctgctgagtagaaaat agaagtcgctattttgctgcttcatatctagaagatgatatatgtgccac ctgggtgtcgtgaactttgtagtcagttttgatggctgatttcttgagta cttctgtcgacattcctagccagcgttcagttatcttattttgttcgtgt tactttctggatggaggttatgantttaaaactaaatatttantttaaaa aaaaaa
Download
page-top