Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695865
Length 462 bp
Fasta Format > whsc2j10
gccggtctggtggccgtgatggcggcagaggaggcggccgaggctttcag agcagacagagtgctggcacagctagcgcagggaagaagaccacatttgg tgacgattagaaactttttgagccacaaaatggtctgatgcaactgccgc gtgtctagacgactgtatccccgtgtttcccattatcctagtggacctag tatcatttgtctgtagtattttcttgccgctatatgttgtaatgccagaa ttctactatatatgttacacctagtgtttttataatacttcctctatcca agtatccaagacaagaagtggtcaggcatctcctataaaatggccaatca ttagtactccctcggtccgaaaaaatttggcccaaacttttaaatggatg gtgctagatacaatcatttgagggataagcttttttggatgaagggaata ccaaaaaaaaaa
Download
page-top