Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695281
Length 406 bp
Fasta Format > whsc1f03
cagtgatcagaaggctatggtggaacttgatgctgcgccatttaagaagt ttgcctcgctgcgagatgaatgggccagcaagaaccgatacatcagccct ggtcccatccagttcagcggccctggaagcgatgcgtcgaaccatacctt gatgttggagcttggcgctgagatatagaggcggcggtgtagagtgtatt tctttcaaattttctacttcttccttgcagttttgagagtggagaacaaa ctcccatagcggagcggcagtctccgcattgtggaatgtttaataagagg ttgagttggagtgggttcagtggatgtcgtaataactaattttagctttt ttatgacccgattgctccccatatatcgaacccccgcctacccctgaaaa aaaaaa
Download
page-top