Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695273
Length 372 bp
Fasta Format > whsc1e18
agctcgcagccatcggacgtcgccgtccgtgcgaagtgccgccgcccgaa cctcccaccacagcacgccgcaatggaggccgaccgcccatggcatcgcc cgagctcacctcccagcagtcattctcctttgaattcgtcgggatccggc tggatccggacgccagcgccccgttcctacctccccacctcgcttgggtc gtcggccagctcgacgatgtcagactgctcgcgggatccagcgccaccgc tggctggccacttcctcctggaggagacgcccccacatcggcgcctcccc atatgagcagcagcagcgaacgcctcgctaagggcatctctggtggtgtt ttttataaattgttttaaagaa
Download
page-top