Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695267
Length 281 bp
Fasta Format > whsc1e09
tgtctctgacttcgttaaagtaggaggtgtccaaaagttgcaggatggcg aatttattgtccaggctacaaaggactgtgtagctaagacattgaagagg ctggaggagaagataaatggacgagtattaaaacacttggtttatctcat gagagtaggagaaaagtctgtgcagaggcgtgttgctctggctcttgcac acctctgtgcccctgaagatcagcgaacaatttttattgataataatggt ctcgacttgcttcttgatcttctggtttcng
Download
page-top