Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695265
Length 560 bp
Fasta Format > whsc1e05
ccgaattcggcacgagggtttttcttcaacaccttgtatgacccctaccg tgaaggtgcggactttgtccgtggataccccttcagccttagggagggtg cccccaccgcggtctctcatggcctttggctgaacatccctgactatgat gcacccacacagatggttaagcctcgtgagaggaacagcaggtatgttga tgccgtcctgactattcccaaggggacactgttccccatgtgtggcatga accttgcctttgaccgtcagctcattggccctgcaatgtactttggcctc atgggtgatggccagcctattggtcgctacgatgacatgtgggctggatg gtgcgtcaaggtcatctgcgaccacttgagccttggagtgaagactgggc tgccatacctgtggcacagcaaggctagcaacccatttgtcaacttgaag aaagagtacaagggcatcttctggcangaggacatcatccccttcttcca gaacgccaccctctccaaggagtgtgacacagtccagaagtgctacatct cactctcnga
Download
page-top