Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695264
Length 250 bp
Fasta Format > whsc1e03
gccgccgccgcaagccgtccgcctcgctcttctcccgagcctggtcctca tcctctcgcctctctccccccacacagatttagcaatctaggtttagcgc ctccgtccatctcgtagctgctgcgatggcgatcaagaggaccaaggccg agaagaagatcgcgtacgaccagaagctctgccagctgctcgaggagtac accaaggtgctcatcgccgtcgccgacaatgtcggctccaagcagctcca
Download
page-top