Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695260
Length 555 bp
Fasta Format > whsc1d22
aggctgagagcaagtgtgctcttgtctacgggcaaatgaacgagcccccg ggtgctcgtgctcgtgttggtctgactggtttgactgttgctgaacattt ccgtgacgctgaaggacaagatgtgctcttgtttattgacaacattttcc gtttcacccaggcaaactctgaggtgtctgctctccttggacgtattcca tctgctgtgggataccaaccaactcttgccaccgatcttggaggactgca agagcggattacgacgacaaagaagggttctattacatctgtccaggcta tttatgtgcctgctgatgatttgacggatcctgctcctgctaccaccttt gcccatcttgacgctactactgtgttgtcacgacagatttctgagctggg catttaccctgctgtcgatcctttggactcgacatcaagaatgctttctc cccacgttctgggtgtggatcactacaacactgcccgtggtgtccagaag gttcttcagaactataagaatcttcaggatatcattgccattttgggtat ggatg
Download
page-top