Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695255
Length 715 bp
Fasta Format > whsc1d17
ggtcttatgagggccactgatgttatgatcgccggcaaggttgccgtggt ctgcggttatggtgatgttggcaagggctgtgcggccgcactcaagcagg ctggtgcccgtgtgatcgtgacagagattgaccccatctgtgcccttcag gccctgatggagggcatccagatcctcaccttggaggatgttgtctctga ggctgatatctttgtgaccaccaccggaaacaaggacatcatcatggttg accacatgaggaagatgaagaacaacgccattgtctgcaacattggtcac ttcgacaatgagatcgatatgaacggccttgagacctaccctggtgtcaa gcgcatcaccatgaagccccagactgaccgctgggtcttccccgagacca agactggcatcattgttcttgctgagggtcgtctgatgaaccttggatgt gccactggccaccccagcttcgtcatgtcctgctcattcaccaaccaggt tattgctcagcttgagttgtggaacgagaaggccactggcaagtacgaga agaaggtgtacgttctccccaagcacctcgacgagaaggtcgcggccctc cacttgggcaagctcggcgccaggctgaccaagctcaccaantcccantc tgactacattancatcccagttgagggtccgtacaancctgcggcctacc ngtactantgtgtcc
Download
page-top