Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695251
Length 699 bp
Fasta Format > whsc1d12
cccccgaactccaaaccctagtagcgccgccgccgccaggtaagaggcga gatggtgtccggctccggcgtgtgcgccaagcgcgtggtggtggacgccc gccaccacatgctcggccgcctggcctcgatcgtcgccaaggagctgctc aacgggcagcgcgtggtggtggtccgatgcgaggagatctgcatgtccgg cggcctcgtccgccagaagatgaagtacctccgcttcctccgcaagagga tgaacaccaagccctcccacggccccatccacttccgcgccccggccaag atcctctggcgcaccatccgcggtatgattccgcacaagaccgcgagggg cgaggccgcgctcgccaggctcaaggcgtacgagggcgtgccgccgccgt acgacaggaccaagcgcatggtcatccccgacgcgctcaaggttctgagg ctgcagcctgggcacaggtactgcctcctcggccagctctccaaggaggt cggatggaactacnccgacaccatcagggagctggaggaaaagaggaagg agaaggccaagatctcctacgacagganaaagcaactggcgaagctccgc gtcaaggccgagaaggcagccganganaagttgggaactcaactgganat cctggcccctatcaaatactaananatatcananctttcntgcgccatc
Download
page-top