Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695249
Length 431 bp
Fasta Format > whsc1d08
agagcaagaagagcgtcgagacctacaaaatctacatcttcaaggtgctg aagcaggtgcaccccgacatcggcatctcctccaaggccatgtccatcat gaactccttcatcaacgacatcttcgagaagctcgccggggaggcctcca agctcgcccgctacaacaagaagcccaccatcacctcccgggagatccag acctccgtccgcctcgtcctccccggggagctcgccaagcacgccgtctc tgagggcaccaaggccgtcaccaagttcacctcctcttagattgcgtcgc ctgtatctagtagcaaatgcagttccttcctgttggtttagtgcttgtct gtggactctggttatctgcaagtaatattagtcctactgttggatgaaaa ttgccgaatcattgccaatgcaaaaaaaaaa
Download
page-top