Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695248
Length 112 bp
Fasta Format > whsc1d06
atgctcaccatctccaaccgctntcaagaactacggcctgaggtacgacg acctgtacgacccctacttcgatctggacatcaaggaggcgctcggcagg ctgccccgggag
Download
page-top