Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695245
Length 202 bp
Fasta Format > whsc1d03
atgattcccaccaagcccatggttgtggagaccttcgccacctaccctcc tcttggccgcttcgctgtgcgtgacatgagacaaacggttgctgttggtg tcatcaagggcgtggagaagaaggaccccaccggtgccaaggttaccaag gccgccatcaagaagaaatgagtgctctggtgtctgccatcgagttatct ag
Download
page-top