Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695242
Length 453 bp
Fasta Format > whsc1c19
ggcatcatccatcccatccccaggtcataaacccaagtcggactcgcctt cctcctcgccaactactcctctcctctcctccgcgcatcgcaccggggtc acctgagatcacacacacaatggtgaaggctgtggctgtgcttaccggca gtgagggtgtcaagggcaccatcttcttcacccaggagggagagggcccg accaccgtgacgggaagtgtcaccggactcaaggaagggctccacggctt ccatgtgcacgctcttggcgacaccaccaatggctgcatgtcaactggac cacacttcaaccccgctggtcatgtgcatggggcacccgaagatgaaatc cgccatgctggtgatcttggaaatgtgacagctggagtggatggtgttgc tagcatcaatattactgactgccatatcccccttactggaccaaaattca att
Download
page-top