Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695239
Length 549 bp
Fasta Format > whsc1c13
acgagggtttctttggacagggcaatggaattggaggcaatggcgacagt atgttcagtgatgtgagtaacatgatgcagcagcagcaagcacaacagcc acagcagcagcagcagcagcagcagcaggccccggcgcagcagcagttct tcatcggtgacgacgcgcaggcgcagttcggcaaccagatgggcagcatc tccggcgcatcggatttcaggttcggctctggcttcaacatgtctggcac cgtcgactacccgcagaagaacgacggccccaactggtactactgaatga agaataaactcctagggtcataagctttcttcgtggcaaaaccaaccttg tgtttccatggggaagtgtcgtcgtcgtcctcctaagaagtgggtaattc tataggtcttctcttaattttcatataggttttgcagtagttgcaaatag gctggaacttggaactggttatatacatgtatgtccatccagctggtgaa cctcttctcttatggaaaacttaattttattcctagttgaaaaaaaaaa
Download
page-top