Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695237
Length 607 bp
Fasta Format > whsc1c11
caaaccccgagcgaagccgtcgccgtgccgtcgtggtctccgtggccatg gtcatccccgagctacgacaagatgcctagaggcaccgccgtcctcttct ccgtcgactccaaccatcggagcaagctgggagggcctcgcgcgtcacca tcgagctcatctccgcctctgcatctcgccgctcgtcgtcttcgattcgg cctcgctggagcctccccgagcccgctctgctcatctacaggctcaacac cccgagactgccggcgaaacccagtacgactacggtgttgacgacccctc cttgccaaagcaaccagatgacggaatccaggagccagatgacacctttg acgactgctactaccccgagggtgcctactaccacgtgacggagaccgcg gatgaccaggagtagttaggaggctcccaggcaggaggccttgccttttc ggtcgatgttgcttttgtgctagccttcttaaggcaaacttgtttaactt atgtctgtactcagatattgttgcttccgctgactcgtttctattcgagc tgatgttttcnagccctcgaggcccctggcttgtaatataaagcttgatt tatttta
Download
page-top