Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695225
Length 264 bp
Fasta Format > whsc1b16
attcggcacgaggagtctgagtcgtcgtgtgtgtggtgtttttgatcgcg agctcgagtgtcgctctgtccggggttaattagagctggttacgcgagga agaaacaacatgtgttactatctttcagtcggtcggtcggtcggtcagtc ggtgatgcagcaatccccttctgtcatggattgggatgtgatgttggaat atcctatgtttgaacaagtttaaatggatgaagaaaatgcaagtcatagc tgcgaaaaaaaaaa
Download
page-top