Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695219
Length 407 bp
Fasta Format > whsc1b10
tgaggcatttgttcgtatggtggacctctttgattcaaggaacaagagag atgagactcaagtttcagcaagacaagagattcatgaaatgatggccatg gtagaagcagatggtggtgcacctgggagtgatgttcatttctatgcttc acagctattcaaggatcagacaaatcgtgatgttttctctgccttcaaga ctcacgagcctagtgcgaggctgatatggataaacaaagcatgggagttc aacaataagtagaacctttatgtttcgaatgctttcaacttgtatcgtan tgaactatgttctgattgctttcaacttgtatcgtactgtcctatattat tcgctttgaacccatgnatttcctttgaacttgcatcctattcanctatg ttatggt
Download
page-top