Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695215
Length 566 bp
Fasta Format > whsc1b06
atagtaatctcctcctctcaagaaaatgccccatcttcctcctaccccag caatggagctcctcggtgcttctgcagctgcagacggtgcatcctggcca gcatttggagacccgggagcggacgagtccaacggcgacgagccttgcag ataggagacggcgggcgcgcgagctagcggctcgcattgtgctctcactg cgtcgtcctcctctgctctgctctgcgagcatgcatgaggcggccggtgc gagcgtgcggtggggaattgaggcgttatggtccgagatatatgtatatc tctctttctctctctctcttttctaggcatcttttaactagttatttgtt cctcctccgagaatatcctcccttcctcttgtttcgtctctgtttcttct tccttctactttggtttgtatccagaggctgtaagcgacgcattcttggc gtggaggagcttgtttgtgatgttangcacctcaatgtgcttggtgaatg tcttgttgancctggaatgcatcngntacactttgtaatgcatgtaatgt aatctgnctgctttta
Download
page-top