Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695213
Length 434 bp
Fasta Format > whsc1b03
ctttagtcttcctgccctgcaccagaagttcgatctgccagcaccttttg ttctgcacacagactgccctcactactggcgcttccatcttcctggtgag acagaagaagaatttgcaacaagacttgccaaaaatttagaggatcttat cctcaaggaaggaccagaaacaattgctgcgttcattgctgagcctgtca tgggtgctggtggtgtcatccctcctccaaagacctattttgataaggtt caagctgtggttaagaagtatgacatccttttcatagtagatgaggtcat taccgcatttggaaggttgggaaccatgttcggatctgatatgtataaca tcaagccagatttagtcaccttggccaaggctctttcgtctgcgtatgtg cccattggagcgactcttgttagccccgaaatag
Download
page-top