Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ695205
Length 664 bp
Fasta Format > whsc1a11
cgggaatccatgcttcgtcgagaatttgataaggcaatacggatcataaa taaattgttttcagaggagaaccagctgcggttcttacattgggatctgc ataaaaactctcaaggagaacctacaaatgtccttgatgttcttctgaaa gtggcatttcgtgctctgacgttgactgagttcttctattgtcaagttgc accacctacagggtctgagactgctcctcactggcctgctctattgcaca gtcacgatccatatttttgtgatgaaaacagcaacagtgacatatcccaa gaagatatctcgggcagttctgactcctctggcaatggaaccacggaaga caaagctgaaaccagtgaactgccccaactaaaaccaccaatcttccaga aaggtgtcttacggacaaattgtatagactgcttggatcgtacaaatgtc gcacaatatgcctatggtttagctgctcttggacatcagctgcatgcact tggttgtgtagaatccccagaacttggtttaggtgctcccgtggctcatc atttgatgcacttttatgagaggatgggtgacacacttgccgtacagtat agcgggtcggctgcacataataagatcttctctgcgaagagagggcactt gaagctttttatac
Download
page-top