Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ584115
Length 766 bp
Fasta Format > rwhrd20n12
caagactcatcgatacaaaatagtgcagctctctttaacaacacaagacc aggtaagggataacagcaccaaaaatttagagcttgtcctcgaaatcgga tagaggggtcatctgctccttgaggcccttcctcttgcggatatccgtga cgagcgtcgccgactgggtgcctgggtccaaaggatcagaagccatgatg tcccagtggtcaaacacacactgggggaaggcctggccggacgtcgcggc cctcagggtgcttgagaacccaaaggattcaatgacggggaggtaggcct tgatgttgtagagcggggtaccttgcctctgcatctcctcgaacacgtgc cctctcttctgattcagaacaccatagataccaccaagcgcattctccgg ggcctggatctcaaccaggtacacaggctccagcagccttggcttggcag tcagctgagaagcataaatgaccctcctggccgtgggaatgacctgacca ccacccctgtggatagcatcagtgtggagaacaacatcacagacctcaaa gcaaatgccacgcatgttctcctcagccaacgcgccttcctttgacgccc actggaaaccagccacaacagagtccttgatttcattaagatactgcact cccttacacatgtcgacgaccatgttggggccagtcgtctcaggtccaaa gcaccaaatcttcttggcaagatccttgtcccacccaaactcctcanaca ggatcttggaccgcac
Download
page-top