Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ583221
Length 561 bp
Fasta Format > rwhrd18k19
cattttcattctaaaaagaccatcccaaggtggtttgcagtactcattgc acagatacttaggtctcaaacatattaaatccgcaaaattcgacctaaaa gcacataagataagtaatccttagcataaaagattccacaggagaactgg aattgaactgcttagtcgaacaagctgaagcccatgtcatcatcgctctc ttccttagcctcctcctttttctcttctttcttctcttcagcggcagcag caccaccagcagccggggcagcagcagcagcagctggagcaccacctcca ccagatccgacggaaaggatgaggtcatcgacgctcctcttctccaggag cttggcgaagagcgcgggccagtaggcctcaaccttgattccggcagcct tcaccaccgtcgcgatcttctcagaagtgatggggatcccgtcatcgtgg aggatgagggcggcaagggtgcaggcgacctcgctggaagacatggcgac ggattctcaccggagcagatctgcgatcttgggaggcgatggaagtggag gcgcaggaggc
Download
page-top