Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ583086
Length 752 bp
Fasta Format > rwhrd18d12
gaacggccaccaccaccactggtatggggctccccccaggccagaccaag gaggcagtccccgcctgctacgctacaagcggcgaccacaaccttccctg gcaacataacatatggggagccccaaatcttgcaataataaccataacac atctaccacacgatccagagcacattgcaacggtcattgacagtagcaaa cactagctagtagcttgcggggcatcgcaaagccggctttactgcccctc gctggagtcatgcttcggagcctccctgatctcctcctccgcggtgtcct ccgtgatgtcggaagtccagagggtcaagttatcacgaaggagttgcatg atcaaggtgctgtccttgtaggattcttcgctcaaggtgtccagctccga aatggcctcatcgaatgcctgttttgcgagattgcaagcacgatcaggcg agttgaggatctcataatagaacaccgagaagtttagtgccagcccaagc ctaatcggatgagttggagccagctcagccaaagcaatatcctgagcagc cttgtatgccaccatggtattctcagcagcatccttcctctcaggcccac tcttgaattcggcaagatacctgtagtagtcacccttcatcttaagataa aagaccttggactcangggcagtggnagacgggacaaggtgggtttcgag cagcttgaggatgccatcccagatcttgctaagctcagtttcgatcttgc ca
Download
page-top