Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ582707
Length 762 bp
Fasta Format > rwhrd16n07
tgcccataagtaaacaaacttgacaacatccaggacctgactctgaacca aactgaaacagaagcacccgtcactgaacgggcttcacggaccggacctt caaagacgatcaacccctcccaccttgacaccaacttagacgtaaagcaa acacaacacacgccaacaattcaatcgaggtccggtcacgggtctcgggc acggcggcgatcaagcgctgggcttgtgctcgcctgtagcggcggcggcc ttgtcctcctcccctgtcttgtggtaaccaggcagcttgtccatgatctt gcccagcaggcccttcttctccttcgcgtcagggctgctcacctcctcgg gggccggcgccggcgcgtgcactggtgctggagcagcgtgcgtgacgggc accgcagcagcgtcctccggcttcttgtggccgccgggcagcttctcctt gatcttttccaagaagcctttcttctcctcctcgggcactgccggtgccg cctctgtcttcacgtcgccgtcgatcttctcgacgacgacgtcggtgtca tggtggccgccgtgggtctgcacagacgcgggggccgccggtgccggtag ccccgtcacgtgctcaccctcggtgtccttgtggccgggcagcttcccct ggagcttttccttgagccccttcttcttcttcctcttgatcacctcgccg ttgtcatcgatcacctcctcttcttcctcgtcactaaannanctgganct gganctggatcg
Download
page-top