Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ582447
Length 741 bp
Fasta Format > rwhrd15n10
gaatctttantatcaaggcataatgcccagcaataaaccaatacacaagt gcccataagtaaacaaacttgacaacatccaggacctgactctgaaccaa actgaaacagaagcacccgtcactgaacgggcttcacggaccggaccttc aaagacgatcaacccctcccaccttgacaccaacttagacgtaaagcaaa cacaacacacgccaacaattcaatcgaggtccggtcacgggtctcgggca cggcggcgatcaagcgctgggcttgtgctcgcctgtagcggcggcggcct tgtcctcctcccctgtcttgtggtaaccaggcagcttgtccatgatcttg cccagcaggcccttcttctccttcgcgtcagggctgctcacctcctcggg ggccggcgccggcgcgtgcactggtgctggagcagcgtgcgtgacgggca ccgcagcagcgtcctccggcttcttgtggccgccgggcagcttctccttg atcttttccaagaagcctttcttctcctcctcgggcactgccggtgccgc ctctgtcttcacgtcgccgtcgatcttctcgacgacgacgtcggtgtcat ggtggccgccgtgggtctgcacagacgcgggggccgccggtgccggtagc cccgtcacgtgctcaccctcggtgtccttgtggccgggcagcttcccctg gagcttttccttgagccccttcttcttcttcctcttgatca
Download
page-top