Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ582403
Length 525 bp
Fasta Format > rwhrd15l04
taacaatgtggctttcttaactacacataagaatgttgcttgtcaagcat caaagatgtacacaaccgagcacctgtcctgggagcaatgtgtatataca gagacggcagactttacacacaaggcacactacacacttgggagggatga aagaaacaaggaagcaagcaagcaaccacggatgaacacttcattcactc ttgctccatttgcgaactaggaacgttttttgcttcaggccccgaagcat cccatgactttcttgggagagtggccggtggcgcggtacttggcggccat ctcctcggccttgaggagttcctcccctttctttgcctcgaccatcgctc tcttctcttcggcctccttgtggatcattgcagccttgttcttcatcttc tctgcgtattccgccttcttcttttccaattgctcctcaatcttcttcag ttgagcttctatgtttgctttcttggtgttctcccatgagagaatagcag atacctttttagtagccttgttctc
Download
page-top