Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ581474
Length 698 bp
Fasta Format > rwhrd12b17
acaaaaaaactaaactaacttccaaataaacattttaagtttgaaagcca taaagaagcagcccagatctctcgttgtagtagtgcaggtacatgtcctt aatcgtctccgagaaggacttcttggcattcttgtgcaggttggacacaa caatcctcgccgcgaacctcgaccgaagcaacggttgatcaacaacagga acctgaacctcgtgatgctagaccatatatctatggttaccctttttatt tctcccgcctaacctgaagtagttatctgaaacctgacggagtttgcttc ggcctccctctcaatggccaacccagaacataatcatcaacctcttggtt cagtcttgatgaggtgtacagaggaaaggcaacattaagatacgcagatg aagctcaaacagccgatgaaaggagaggacatgaagcaaccatggtcagc atgagtgcagcacgatcagcatgttcatagaaccacttccataaacagtt ccagtatatgggttaaacaacaggcatgacaccacatcgcatgctaaggc actgaaacctgctgaatttgtgcacctgaaacctgatgatgttttctttg ctctacctcggagtagtctttgggaggcggatgacccagagataggaagc atagactcgaaaaaatgacaagaataatttattgagaactccatgtag
Download
page-top