Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ586010
Length 756 bp
Fasta Format > rwhrd8n05
gagcaataacactcaggtagtaatactacgaatcaactcgatctaaggtc caaaaacctcacagggcagatatgttatgcttgctttagctacgacacca tcacggcaacagaaaactgtagatatattgtgcgcccaccgccatcacct gcctcaggaagatttagattttgttgaaggcaacaatgtcacagctctgg atgtactcgttggctggttcaacgcagagatggtcttcaataagagtgtc gacagagacgaggtcatcaatgatggtcatcataatctggagcttcttga tgccatatccaacgggcatgagcttggaagcaccccacagaaggccctcc atcttgatgcttcggacagcttcctccagcttgaccatgtcggtctcatc gtcccatggcttaacatcaagcaaaactgatgacttgccagattctttct tcttggtagaagcctttgctttggcagcgcgctcttcagctgcctttttc tcctcctcggtttcctctccaaaaaggtcaacatcgctgtcatcgtcatc atcagctgcaggagcctcagcaacatcagtagttgaggtttcagggacaa ctgatgacagaaccttcacaccttgaccaggggcagtaactccactcagc ttcaggagtgcatcaatgtgattgtaccaccttgcaacattggtgcaagt tgatggtggagcaactgagaactctgaatacacagccnagtcatccttgg aagctt
Download
page-top