Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ585415
Length 759 bp
Fasta Format > rwhrd6j22
cattccctttacagttattgttcacctagcccactcatctacttacatgg acgacatgcttcaaaatgtacaccaaacaaaacagctacgagtaagtaaa tcctggtcattctacctccaaagcagtcaggtcaccgctgcgtatacaac cttgatggcttgatcagtcaggacaccgttacagcgtcagcttttcagtt atcaggaactctacacagccttggacatgaccgtgaacggaatgaccacc cggtggcccctgtccccatagaactcgacgtccccgaagctcgccgaaga gttggtcatggtggcgttcacgacgaaggtcacgagctgcttctgcccgc tggggatgaagaactgtgctggtgccgcggacgccgccaccccgtagggg gcgttgcagctgaccgtgtagttctcgtcgctcgccacgttggtgattgt tcgcgttattgttcttgactggttgagcacggctatagtgatcgacggca ggtttaggtctgctccggtcatggtggaggccctgcagctgctgccggtg tagttcgccactactggagcagagccatttataccacacagaaaggagag gtagtcatcgtaattgcaatcaaatatgagcccagggtccaaagcagcag tggcattggcaaacccattccccatgtcaaaaggtgtagctggagtttgt gtggagtctgggttgctgtatgttcgctgtgacatgattggattcccctg cttgtcact
Download
page-top