Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ585218
Length 775 bp
Fasta Format > rwhrd5o16
aacgataatactggtaagcaggacacccaaacaggccaccgcaccgaagg cagatcagtacttgtagtccttgacgtggaggctctcagaggccccctcg ccgagggtggcatcgcccttgtaggtgccgagggtggcctcagagttggc cttgcacctcaccaggaacgccttcctggccttctcctcgttctccacct tgccagcccaggccttgagggtgctctgctggagggcacgcccgaaggag aaggacaggttccatggcttcttggtctcgagcttgttcatggcgttcag gttcagggtcgcctcctcctcgctctgtccaccagagaggaagacaatgg ctgggacggcagcagggacagtcctctggagggtgcggacggtgtactca gcaatcacctcaggggccaccttcttggcgtcggatccaggggtgaccat gttgggcttcaggagggtgccctcaaggaggacatgctggtcgttgaggg ccttgtagcacgcagcaaggaccatctcagtcacgtaagcacagcggtca atgtcatgaggtccatcaacaaggatctcaggctcaacaatgggcaccag cccattctcctggcagatgatggcatagcgagccagaccctgagcattct ggtcgatggaaagctgtgatggctcggtggggccaatcttgangacggca cgccacttggcaaancgggcaccancctcntaatacttggcacancnctt gccaaggtcatcaaanccttgggtg
Download
page-top