Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ584736
Length 761 bp
Fasta Format > rwhrd4d06
gaaaaggagcatgcatcgcgatgtgcggctgttctgggtggagacgagag tttctaaggagcggaaggtttcatttattcaaaacatcagaggagcagct gcccttcgaatgtggatttacgcgaggcatgagtaggccagcgccttctc ctccgacagctcctgggcggtggcatccatcttcttcctcgagaactcat cgatcgggagcccttgaacaattgtccattcaccaccactgcacgttact gggaaggagtagataagaccagcaggcacaccgtatgaaccatcagagta cacacccatggaaacaaatgttccctcggcggttcccagaacccagtcac ggatgtgatcacaagctgagctggcagcagagagagcactggagagcttc ctcgctttgatgattgcagcaccacgctgctggacagtggcaatgaactc cccgtttagccattcatcatcttgaacaagttcacgaacaggcttctctc cactggaagtcttcacagtggcgtggttaacatcagggtactgactggac gagtgattaccccagataatagcattcttcacgtcagaaacttggacacc aagtctctcagaaatctgaccgagtgccctgttgtggtctaggcgggtca aacaactgatgttcttctcagggatagatggagcaaactccttcaggatg agagcattggtgtttgctgggttggcaacaaccaaaaccttgcagttggg ggctgcatgag
Download
page-top