Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ222350
Length 215 bp
Fasta Format > whdl12p21
ccacaggttccaccagtaccaggtggtgggtcgcgcgctgccggcccccg gcgatgagcagcccaagatctaccgcatgaagctctgggccaccaatgag gtccgngccaagtccaagttctggtacttcctgaggaagctcangaaggt gaagaaggccaacggctcagatgctcgccatcaacgagatctttgagaag aaccccaccacaatc
Download
page-top