Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ584285
Length 622 bp
Fasta Format > rwhrd2h21
aagtgtgcagcgatatggtaggcaatggagccactaaggccctttgctaa gtaacaactacaaaattccaataacataagaaaccacgacacaagcgcct actgcaggaccctccctctggcttatatgatgccgatcttgttggccacg tcaagagcatcgtagtctggtgtcagcttcacgtacgccttcttcttgcc atcaggcctgatgagggtgttaaccttcttggcctgaatgtcatacattt tcttgacagcagcctttattttcttcttgtcggccttgaggtcgacaatg aagacaagggtgttgttgtcttcaatcttcttcatcgcagactcagtggt aagcgggtacttgaggatctggtactggtctaatttgttccttccagggg tgctgatcctggggtacttggggtccctggccttggacagggtcttgggg cggtgaaatgtcacagaagtgcggatcttctttgccgtcttcttgattga cccagacttcacagccttggcaaccttggcggcctgggccttggcatcgc ccttcttggcaacagcaactttgggagccatttgagcttctcanaaaagc ctcttgaacttaccttcctggg
Download
page-top