Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ583768
Length 760 bp
Fasta Format > rwhrd1j20
atgtttgctactatatcctataattctgtcataataacatagtacatcca taggaaggaggggaaaccattttattctgctacctcaaattacaaaaaaa ttattggcaaaggggcggcggaaaactttgtacagtttgacaacatgctc gttcatctgaatatagggcaaaactctgctaccaagcgcctaataagagc aaagtaagcaataccatcttccaacacattgcactgcttgcaggtctcag ggagcgcagcaacctctcagctgaccgaagtgcagattgactgctgagag tagagaccgtttatggggttcacgaagtgctgcttgcttttcctacgctt tgagaccactgtaaacccctctgtatccttctcgctcttgggcacctcgg cggccttcggttgtttgtcgaactctttcggacttacggcagtcttggtt acgttgctgctctgttcgttactagcttcatctgacccgcttggttttct gtccggttgaggtcgagtcgaacctaagctgtcatggaccgacttgacaa tgaagctgagcagaatctgccttgcaagttctgctttgtatgaatctctt gtcgcctctttcgctcgttccttcactttacctggagttgtcttctccac ttgacctgccttgtctgcctcacgaacatcgactttcactccatctgagg catgtgatgccaactgctgatctgctggatcacttacagaattagtttgt tcccctgcag
Download
page-top